Dong!

'OH-EIGHT HUNDRED HOURS.' The loudspeakers. The tranquillity of Kirkegata Street was gone. There was no steeple, no ochre-coloured house. Trondheim's bells weren't to blame for the noise in his head. He had an almighty headache.

Johanson opened his eyes and found himself lying amid rumpled sheets in a strange bed. Other beds were lined up around him, all empty. It was a big room, full of equipment, with no windows and a sterile appearance. A sickbay.

What the hell was he doing here?

His head lifted and fell back on to the pillows. His eyes closed of their own accord. Anything would be better than the hammering in his head. He was even feeling nauseous.

'OH-NINE HUNDRED HOURS.'

Johanson sat up. He was still in the same room. He felt significantly better, though. The queasiness was gone, and his head no longer felt as though it were being crushed in a vice. The pain had subsided to a tolerable ache.

He still didn't know what he was doing there.

He looked down at himself Shirt, trousers, socks – the clothes he'd been wearing last night. His down jacket and sweater lay on the next bed, with his shoes arranged neatly on the floor.

He swung his legs over the side of the bed.

A door opened and Sid Angeli, the head of the medical unit, came in. He was a small Italian with a thin circle of hair and deep creases round his mouth. He had the most tedious job on the ship since no one was ever ill. That seemed to have changed. 'How are you feeling?' Angeli cocked his head. 'Everything OK?'

I'm not sure.' Johanson touched the back of his head and flinched.

'It'll be sore for a while,' said Angeli. 'Don't worry, though – it could have been worse.'

'What happened?'

'You can't remember?'

Johanson thought hard. 'I could use a few aspirin.'

'But you don't know what happened?'

'No idea.'

Angeli came closer. 'Uh-huh. Well, you were found on the hangar deck in the middle of the night. You must have slipped. Thank God the ship is under video surveillance or you'd still be there. You probably hit your head on one of the struts.'

'On the hangar deck?'

'Yes. Don't you remember?'

Of course. He'd been on the hangar deck with Oliviera. Then a second time, by himself He could remember going back there, but he couldn't think why. And he had no recollection of what had happened next.

'It could have been really nasty,' said Angeli. 'You, er, hadn't been drinking, had you? I only ask because there was an empty bottle down there. Sue Oliviera said the two of you had cracked open some wine.' Angeli splayed his fingers. 'Don't get me wrong, Dottore, it's not a problem, but helicopter carriers are dangerous places. Wet and dark. It's easy to slip over or fall into the sea. It's better not to wander around on your own if you've, er…'

'. . . had a glass or two,' Johanson finished for him. He got up, and the blood rushed to his head. Angeli was there in an instant, holding his elbow. 'I'm OK, thank you.' Johanson shook him off 'Where am I anyway?'

'In the infirmary. Can you manage?'

'Provided you give me those aspirin.'

Angeli walked over to a shiny white cabinet and took out a packet of painkillers.

'Here you go. You hit your head, that's all. You'll soon feel fine.'

'OK. Thanks.'

'Are you sure you're all right?'

'Yes.'

'And you can't remember anything?'

'Like I said, no.'

'Va bene.' Angeli gave a wide smile. 'Take things gently today, Dottore, and if you experience any problems, don't hesitate to come back.'

FLAG COMMAND CENTER

'Hypervariable sections? What the hell's that supposed to mean?'

Vanderbilt was struggling to keep up. Oliviera realised that she was in danger of losing her audience. Peak looked bewildered too. Li's expression was as inscrutable as ever, although it seemed likely that her knowledge of genetics was under severe strain.

Johanson sat among them like a ghostly presence. He'd turned up late, as had Rubin, who'd come in mumbling apologies for his absence. But, unlike Rubin, Johanson seemed genuinely ill. His gaze was unsteady and he kept glancing around, as though he needed to reassure himself every few minutes that he wasn't hallucinating and that the people around him were real. Oliviera made a mental note to have a word with him.

'It might be easier if we started by talking about normal human cells,' she said. 'You can think of our cells as bags of information wrapped in membranes. Inside each cell is a nucleus, and inside the nucleus are the chromosomes – home to our genes. The genome is the complete set of genetic information, the full sequence of DNA, the famous double helix. In simple terms, it's our design plan. The more complex an organism, the more sophisticated the plan. The results of a DNA test can be used to find someone's killer or prove that people are biologically related, but by and large we all share the same blueprint: feet, legs, torso, arms, hands and so on. In other words, an individual's DNA can tell you two things: first, that they're a person; and second, who they are.' She saw interest in their faces. It had been a good idea to start with some basic genetics.

'Of course, two individual humans will have less in common than two single-cell organisms of the same species. Statistically speaking, there'll be three million small differences between my DNA and the DNA of any other person in this room. Human beings are differentiated from one another by roughly one difference per twelve hundred base pairs. What's more, if you were to take two different cells from the same individual, you'd still find small variations -biochemical discrepancies in the DNA, caused by mutations. Consequently, the results will be different if you analyse a cell from my left hand and one from my liver. But the DNA will tell you clearly that those cells belong to Sue Oliviera.' She paused. 'Single-cell organisms are a slightly different story. The cell is the entire organism. So there's only one genome, and since single-cell organisms reproduce asexually, there are no parent cells to pass on their chromosomes. It works by cell division. The organism duplicates itself and all its genetic information.'

'So, as far as single-cell organisms are concerned, if you know one DNA sequence, you know them all,' said Peak, choosing his words carefully.

'Yes.' Oliviera rewarded him with a smile. 'That's what you'd expect. A population of single-cell organisms should have largely identical genomes. Apart from a minimal rate of mutation, their DNA should be the same.'

She saw Rubin shifting impatiently on his chair, desperate to speak. Usually he would have tried to butt in by now and take the lead. Poor Mick, thought Oliviera, in satisfaction. What a shame you were confined to your bed last night with a migraine. For once there's something you don't know.

'But that's exactly the problem,' she continued. 'At first glance, the cells in the jelly appear identical. They're amoebas – not even a particularly exotic variety, just ordinary deep-sea amoebas. But it would take at least two years and a whole army of computers to decode their DNA in full, so we settled for analysing a diagnostic section. We isolated the DNA and amplified key regions for sequencing. We call them amplicons. Each amplicon contains a sequence of base pairs – the language of genetics. Now, when we compare amplicons from DNA belonging to different individual organisms, we see something interesting. Amplicons of different organisms belonging to the same population should look something like this.'

She held up a print-out that she'd blown-up for the meeting:

Al: AATGCCAATTCCATAGGATTAAATCGA

A2: AATGCCAATTCCATAGGATTAAATCGA